rs2755094 chr1:225977598 A>G
- Sequence
gggttgccattttaaaccgagtga[A/G]aggtgagagagtcttccctgggga
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 2.58 | -4.50 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, bipolar disorder, college completion, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol, triglycerides, triglycerides change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Thyroid