rs2755429 chr10:87656707 C>A
- Sequence
gaccacccagtggtgttgcctcca[C/A]gttagagcccctaatatgatgagc
- ASB in cell types
- A549 (lung carcinoma) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.22 | 1.06 | 2.00 | |||
| erythroid progenitors | n/a | 2.40 | 2.00 |
Items per page:
1 – 2 of 2