rs2758233 chr6:63500882 C>T
- Sequence
actgggattagaggcacgtgccac[C/T]aggcctggctaatttttatatttt
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.14 | 1.05 | 2.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Lung, Muscle_Skeletal, Prostate, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood