rs2758811 chr6:152643270 G>A
- Sequence
gccagcctctgtaaaactactgcc[G/A]ttgccgctggagggagaatttctc
- ASB in cell types
- adrenal gland spleen
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | -1.39 | 1.95 | 1.11 | |||
| spleen | 1.38 | -0.41 | 1.00 |
Items per page:
1 – 2 of 2