rs2760501 chr1:58785425 T>G
- Sequence
atcctggttctttcgtggccaggc[T/G]accacagtgtgaagcaagcaaatc
- ASB in cell types
- primary B-CLL cells 22RV1 (prostate carcinoma)
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.89 | 0.96 | 1.45 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, mitral annular calcium, total cholesterol change with statins