rs2761442 chr1:110197242 A>G
- Sequence
ggggtatgatgtgacggaatcaga[A/G]gaggttagaggaggacagtagagc
- ASB in cell types
- HEK293 (embryonic kidney) CD34+ stem cells-derived erythroblasts thoracic aorta GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.05 | 0.68 | 1.93 | |||
| CD34+ stem cells-derived erythroblasts | 1.86 | -1.12 | 2.00 | |||
| thoracic aorta | -1.56 | 1.95 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.52 | 1.24 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, anti-cytomegalovirus igg titer, aortic valve calcium, comorbid depressive syndrome and alcohol dependence, hip bone mineral density (bmd), irritible bowel syndrome, ldl cholesterol, primary rhegmatogenous retinal detachment, salmonella-induced pyroptosis, spine bone mineral density (bmd), total cholesterol, years of education