rs2762943 chr20:54174247 T>G
- Sequence
accccggagataacccccaggaag[T/G]catgcgaagcccggagttcaccgg
- ASB in cell types
- macrophages
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 1.18 | 3.44 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1