rs2763405 chr13:78121729 A>G
- Sequence
gtttggtacgtaaaacacgttcac[A/G]ctgaaaataatggctaagatcaac
- ASB in cell types
- neutrophils glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils | 2.52 | -1.55 | 2.00 | |||
| glioblastoma cells | 0.73 | n/a | 1.50 |
Items per page:
1 – 2 of 2