rs2764587 chr13:46291157 A>G
- Sequence
tgtgtgagtccaggaactggagct[A/G]cctgtcccttttgagggagttcct
- ASB in cell types
- LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | -4.94 | 3.04 | 1.50 |
Items per page:
1 – 1 of 1