rs2765269 chr1:62296092 G>T
- Sequence
gtgttcaaagaatcagcagttaag[G/T]agaaaaaagttaattggaagcaat
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) EOL-1 (Acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | -0.47 | 1.44 | 1.00 | |||
| EOL-1 (Acute myeloid leukemia) | -1.71 | 2.11 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), infant head circumference, total cholesterol, triglycerides change with statins