rs2766679 chr20:53594087 A>G
- Sequence
ccccacccccacccccgcccggag[A/G]atataggggccgggctcacctcgg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MOLT-4 (Adult T acute lymphoblastic leukemia) GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.98 | 2.30 | 3.38 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.16 | 0.32 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.06 | 0.93 | 1.00 |
Items per page:
1 – 3 of 3