rs2767073 chr10:35940084 A>G
- Sequence
gatactcccccgcacttcatcccc[A/G]tgatggcttttgtctgttatcata
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 1.86 | -0.87 | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, body mass index (bmi), diastolic blood pressure (dbp), total cholesterol, triglycerides, years of education