rs2767365 chr14:68140306 G>C
- Sequence
atccatcttgcttttccttttcct[G/C]caactcagctggtgtgcaggtgta
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | 2.34 | -0.38 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1