rs2767485 chr1:65513234 T>C
- Sequence
aactggtagctctgcctagatcca[T/C]gtgcttggtgttagggaaggaaca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZN592_HUMAN LMBL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN592_HUMAN | n/a | 3.64 | 2.00 | n/a | n/a | |||
| LMBL2_HUMAN | n/a | 3.00 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP age at menarche, comorbid depressive syndrome and alcohol dependence, insulin, obesity with early age of onset (age >2), plasma soluble leptin receptor (sob-r) levels, tnfr2
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Spleen, Whole_Blood