rs2770296 chr13:46866425 C>T
- Sequence
gggctgtgcaatcaactcaggcct[C/T]aggggagagagcagctgaggaatg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | n/a | 2.21 | 2.79 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, diastolic blood pressure (dbp), hip bone mineral density (bmd), ldl cholesterol change with statins, paired associates learning total errors 8 patterns, prop taste detection threshold, pulse rate, schizophrenia, spine bone mineral density (bmd), stabilized warfarin dose, total cholesterol change with statins, waist hip ratio