rs2770417 chr14:47917461 T>A
- Sequence
gatacacactaaattttcagaatc[T/A]ttgccttacttccctcgaagtaaa
- ASB in cell types
- foreskin keratinocyte gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.20 | 2.00 | |||
| gastroesophageal sphincter | 2.31 | 0.62 | 1.00 |
Items per page:
1 – 2 of 2