rs2771339 chr14:20987028 A>G
- Sequence
cagaaaaccctgtacaatccgtga[A/G]tttcttcatggttgagactcagat
- ASB in cell types
- HKC8 (kidney proximal tubule cell line) TTC-1240 (Rhabdoid tumor of the kidney) HEK293 (embryonic kidney)
- ASB for transcription factors
- EPAS1_HUMAN SCRT2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EPAS1_HUMAN | n/a | 3.10 | 1.00 | n/a | No Hit | |||
| SCRT2_HUMAN | -1.85 | 2.16 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood