rs2776796 chr6:37204258 C>T
- Sequence
tattcacatacacatacacaaaca[C/T]agatacccaaacatacacacatag
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.39 | 1.08 | 2.00 | |||
| K562 (myelogenous leukemia) | n/a | 2.79 | 3.00 |
Items per page:
1 – 2 of 2