rs2777812 chr1:157969994 T>C
- Sequence
accaaatcccatcatattgttcct[T/C]agcctacaatcctgcagtggctcc
- ASB in cell types
- A549 (lung carcinoma) RH4 (alveolar rhabdomyosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.15 | 0.20 | 2.00 | |||
| RH4 (alveolar rhabdomyosarcoma) | -0.51 | 1.20 | 1.17 |
Items per page:
1 – 2 of 2