rs2779159 chr1:157580567 C>T
- Sequence
ctcctgagttaagtatgtaattgt[C/T]tgagaatttattaagactcaagtc
- ASB in cell types
- H929 (plasma cell myeloma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -2.65 | 1.77 | 1.50 | |||
| foreskin keratinocyte | 1.22 | -2.42 | 2.00 |
Items per page:
1 – 2 of 2