rs2779524 chr9:98576573 C>T
- Sequence
ttaaaatcctggccctactactta[C/T]tagctgtgagtccttgtgcaagtt
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.63 | -0.96 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, hemoglobin (hb), major depressive disorder, nicotine dependence (smoking), smoking cessation in a trial of precessation nicotine replacement, waist hip ratio