rs2783046 chr1:71588165 G>C
- Sequence
ttgaacccatagatggcaggatgg[G/C]accactcagttcatagtctttaaa
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | -5.01 | 2.92 | 2.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 2.00 | -1.70 | 1.00 |
Items per page:
1 – 2 of 2