rs2783478 chr5:55227592 A>G
- Sequence
cctgggtaccgtcttcccgcttac[A/G]gacagggggaatggcaaagttaac
- ASB in cell types
- MRC-iPS-25 (induced pluripotent stem cells) K562 (myelogenous leukemia)
- ASB for transcription factors
- CTCF_HUMAN JARD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.96 | 0.56 | 1.34 | n/a | No Hit | |||
| JARD2_HUMAN | 2.00 | -0.97 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid