rs2784041 chr9:136792104 G>A
- Sequence
ctagggttggggctgtggttctgc[G/A]tccctgactctgacatggagcccc
- ASB in cell types
- GM10847 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 0.21 | 1.00 | 1.00 | |||
| foreskin keratinocyte | 1.03 | n/a | 2.67 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.34 | 0.67 | 1.08 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Vagina, Whole_Blood