rs2785193 chr11:35073888 A>C
- Sequence
aggtttaattgacttacagctctg[A/C]ctggttggggaggcctcaggaaac
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.82 | 2.11 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Hypothalamus, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid