rs2786014 chr1:234761496 G>A
- Sequence
ttctacactttctgtgacaaacaa[G/A]ccactgggcttcctttgacttctt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- P53_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P53_HUMAN | n/a | 2.92 | 1.00 | -2.98 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP chronic kidney disease, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, hypertension (early onset hypertension), late onset alzheimers disease, refractive error, salmonella-induced pyroptosis, serum creatinine, total cholesterol