rs2786143 chr1:111334264 A>C
- Sequence
atataccaagaaagaaagaacatg[A/C]aaagccaaaatctcagagagaaaa
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) IPSC-derived bipolar neuron upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.00 | -0.81 | 1.00 | |||
| IPSC-derived bipolar neuron | 2.48 | 0.39 | 1.00 | |||
| upper lobe of left lung | 0.03 | 1.63 | 1.00 |
Items per page:
1 – 3 of 3