rs2786900 chr10:132572110 C>A
- Sequence
tttgacagctcatgtctggcaccg[C/A]agatagtctaggaaaaggtgactc
- ASB in cell types
- germinal center CD77+ B cells GM12878 (female B-cells lymphoblastoid cell line) breast tumor
- ASB for transcription factors
- FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXP1_HUMAN | 2.73 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1