rs2787961 chr1:246078742 A>G
- Sequence
ctggcagtgtggctgaagaaaaac[A/G]cctagctaaaagagaacaggaagc
- ASB in cell types
- HepG2 (hepatoblastoma) MV-4-11 (Childhood acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.18 | 0.09 | 1.14 | |||
| MV-4-11 (Childhood acute monocytic leukemia) | -2.22 | 2.19 | 1.00 |
Items per page:
1 – 2 of 2