rs2788472 chr7:158856613 T>C
- Sequence
ttctgggccctctgctgctcctgc[T/C]tgtcggttgctaggcgctgggacg
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) U87 (glioblastoma) HEK293 (embryonic kidney)
- ASB for transcription factors
- NRF1_HUMAN BRD3_HUMAN RAG2_HUMAN GATD1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 2.04 | -1.32 | 1.33 | -0.89 | Weak Concordant | |||
| BRD3_HUMAN | 1.99 | -0.77 | 2.00 | n/a | n/a | |||
| RAG2_HUMAN | 2.42 | -2.16 | 1.00 | n/a | n/a | |||
| GATD1_HUMAN | 2.19 | -1.85 | 1.00 | n/a | n/a | |||
| FOXK2_HUMAN | 2.79 | 0.76 | 1.50 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Pancreas, Pituitary, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood