rs2788473 chr7:158856589 T>C
- Sequence
gccgcagggcacgctgggcagtgc[T/C]tctgggccctctgctgctcctgct
- ASB in cell types
- HepG2 (hepatoblastoma) U87 (glioblastoma) VCaP (prostate carcinoma) UCLA1 hESCs
- ASB for transcription factors
- NRF1_HUMAN BRD3_HUMAN AP2C_HUMAN MBL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 2.55 | -4.34 | 1.33 | n/a | No Hit | |||
| BRD3_HUMAN | 3.06 | -1.91 | 2.00 | n/a | n/a | |||
| AP2C_HUMAN | 3.20 | -3.19 | 1.00 | 2.88 | Discordant | |||
| MBL2_HUMAN | 2.60 | -3.10 | 1.00 | n/a | n/a | |||
| STAT1_HUMAN | 2.09 | -0.93 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 13
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Pancreas, Pituitary, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood