rs2788996 chr6:117907364 A>C
- Sequence
agacccgggcacgaggaaacaagg[A/C]gaaatcaggactccttccccggaa
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 2.07 | -1.86 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | -2.92 | 2.81 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), hypertension (early onset hypertension), ldl cholesterol