rs2789731 chr1:216750131 C>T
- Sequence
agctttattgattatcatccattg[C/T]agtttgtagagaagtctgtttaca
- ASB in cell types
- foreskin keratinocyte RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.95 | n/a | 2.50 | |||
| RWPE1 (prostate epithelial cells) | 2.14 | -1.58 | 1.00 |
Items per page:
1 – 2 of 2