rs2791418 chr10:6918371 A>C
- Sequence
tggaaggcatttaaagccatgaga[A/C]gggatgagtgcacctaacgggaag
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -0.72 | 1.81 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.75 | 1.56 | 1.00 |
Items per page:
1 – 2 of 2