rs2791718 chr1:203172296 C>A
- Sequence
gtgtgaactggtaagcatcctggg[C/A]actcccttggcgcctcgactctgc
- ASB in cell types
- T47D (invasive ductal carcinoma) esophagus squamous epithelium
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.93 | 0.70 | 1.00 | |||
| esophagus squamous epithelium | 2.49 | -2.10 | 1.00 |
Items per page:
1 – 2 of 2