rs2794845 chr1:237851511 G>A
- Sequence
tcctaatataattattatacaacc[G/A]tgttgcaccacattgagacaagtt
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) foreskin keratinocyte THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 3.27 | -3.34 | 1.00 | |||
| GM02630 (Fanconi anemi) | -1.08 | 2.75 | 1.33 | |||
| foreskin keratinocyte | 0.92 | n/a | 2.33 | |||
| THP-1 (acute monocytic leukemia) | 0.58 | 0.91 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -0.70 | 1.69 | 1.00 |
Items per page:
1 – 5 of 6