rs2796249 chr1:207865339 G>A
- Sequence
gctttccagacatcaaatcagagg[G/A]cttcagaactggaagaagctagat
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | -1.03 | 1.49 | 1.00 | |||
| breast tumor | 2.45 | -0.53 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, hdl cholesterol, ldl cholesterol change with statins, obesity with early age of onset (age >2), primary rhegmatogenous retinal detachment, refractive error, stabilized warfarin dose, tardive dyskinesia, total cholesterol change with statins, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen