rs2797201 chr1:115829569 G>C
- Sequence
acacggaggcctccctcacctgct[G/C]ctttgcagtccctttgaagtttcg
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.35 | -1.27 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Frontal_Cortex_BA9, Esophagus_Mucosa, Skin_Sun_Exposed_Lower_leg, Whole_Blood