rs2797420 chr1:116827508 G>A
- Sequence
tccagcaaccttttccttcacttc[G/A]tctcagccaccgatacctgtaatc
- ASB in cell types
- Th1-cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Th1-cells | -0.81 | 2.32 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, fasting insulin, homa-ir, triglycerides, triglycerides change with statins