rs2797533 chr1:110644162 C>T
- Sequence
cgctttcaaaactgaaggaatggt[C/T]gagttgccatggcaaccctctgcc
- ASB in cell types
- MDM(monocyte derived macrophages) GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.69 | 1.92 | 1.74 | n/a | No Hit | |||
| TF65_HUMAN | n/a | 2.79 | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence, alcohol dependence (early age of onset), alcohol dependence without depressive symptoms, comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), height, obesity with early age of onset (age >2)