rs2797920 chr10:35916992 T>G
- Sequence
agcattggctagatgaagggaggc[T/G]ccctccagttgtacttgtttatgc
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines) RWPE2
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -2.34 | 2.07 | 1.17 | n/a | n/a |
Items per page:
1 – 1 of 1