rs2798138 chr1:113629174 A>C
- Sequence
aggctgtcttcaagctcactaatt[A/C]tttcttctacttgatcgattctgc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- TIF1A_HUMAN SMCA5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TIF1A_HUMAN | -2.52 | 2.68 | 1.25 | n/a | n/a | |||
| SMCA5_HUMAN | -2.33 | 2.58 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid