rs2798641 chr6:108946847 C>T
- Sequence
ttgatattgtttcttccccacagt[C/T]aacattatgcacatgagttatttt
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.10 | -0.55 | 2.00 | 2.41 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
EMBL-EBI fev1, lung function (fev1/fvc), peak expiratory flow, pulmonary function, pulmonary function (smoking interaction)
GRASP airflow obstruction, body mass index (bmi), diastolic blood pressure (dbp), lung function, forced expiratory volume in 1 second (fev1), lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), lung function, forced expiratory volume in 1 second (fev1) smoking pack years, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), in ever smokers, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), in nonsmokers (never smokers), parkinsons disease, schizophrenia, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), weight loss after gastric bypass surgery
PheWAS acute appendicitis, allergy/adverse effect of penicillin, anomalies of pupillary function, anterior pituitary disorders, anticoagulants causing adverse effects, arthralgia/ankylosis of temporomandibular joint, ascites (non malignant), atherosclerosis of renal artery, benign neoplasm of other parts of digestive system, carditis, chronic cystitis, chronic periodontitis, complications of gastrostomy, colostomy and enterostomy, congenital pigmentary anomalies of skin, conjunctivitis, infectious, decubitus ulcer, deviated nasal septum, diffuse diseases of connective tissue, disaccharide malabsorption, diseases of hair and hair follicles, disorders of sweat glands, disorders of uterus, nec, disorders of vitreous body, dystrophy of female genital tract, eating disorder, endocarditis, exophthalmos, fracture of foot, gastric ulcer, gastrointestinal complications, generalized hyperhidrosis, genitourinary congenital anomalies, gingival and periodontal diseases, hemorrhagic disorder due to intrinsic circulating anticoagulants, hx of malignant neoplasm of oral cavity and pharynx, hypercholesterolemia, hypotension nos, infection of the eye, internal derangement of knee, intervertebral disc disorder with myelopathy, iron deficiency anemias nos, lipoprotein disorders, localized adiposity, loss of teeth or edentulism, malignant neoplasm of kidney and other urinary organs, malignant neoplasm of renal pelvis, mechanical complications of cardiac/vascular device, implant, and graft, morbid obesity, multiple sclerosis, orthostatic hypotension, other cardiac conduction disorders, other diseases of the teeth and supporting structures, other disorders of eye, other disorders of gallbladder, other disorders of lipoid metabolism and hyperalimentation, other disorders of urethra and urinary tract, other local infections of skin and subcutaneous tissue, other specified diseases of hair and hair follicles, other sprains and strains, other symptoms referable to back, otitis externa, otosclerosis, periodontitis (acute or chronic), pilonidal cyst, pityriasis, poisoning by agents primarily affecting blood constituents, postlaminectomy syndrome, posttraumatic wound infection, salicylates causing adverse effects in therapeutic use, sebaceous cyst, secondary thrombocytopenia, spasm of muscle, symptoms of the muscles, systemic sclerosis, tobacco use disorder, ulceration of intestine, ulceration of the lower gi tract, urinary calculus, vaginal enterocele, congenital or acquired, viral warts & hpv