rs279910 chr9:975112 G>A
- Sequence
aacgggaacagctaagggcttcaa[G/A]ggaaacacacaactggggttcggt
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
- ASB for transcription factors
- KDM2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM2B_HUMAN | 2.36 | -0.42 | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, comorbid depressive syndrome and alcohol dependence, fasting blood glucose, fasting insulin, glucose effectiveness, hip bone mineral density (bmd), insulin disposition index, insulin sensitivity index, rheumatoid arthritis, schizophrenia, spine bone mineral density (bmd)