rs2800191 chr10:90652538 A>G
- Sequence
aactcctcaagagaagttttgccc[A/G]ttttccccagtttcaaaattctct
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) GM19238 (female B-cells lymphoblastoid cell lines) GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.66 | 1.53 | 1.06 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Colon_Sigmoid, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid