rs2800245 chr9:36798695 A>G
- Sequence
caaaatctccccagctgcagccct[A/G]gtgggatttcataactgctttctt
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 3.05 | -2.88 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | n/a | 3.42 | 1.33 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -4.42 | 3.04 | 1.33 |
Items per page:
1 – 3 of 3