rs2800783 chr1:164617855 C>T
- Sequence
atgtgtggatctcctttcagcagg[C/T]tctatctttacctccaaagtgctt
- ASB in cell types
- foreskin keratinocyte GM12892 (female B-cells lymphoblastoid cell line) TTC-1240 (Rhabdoid tumor of the kidney) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.70 | -3.73 | 2.17 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 1.59 | -0.64 | 1.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | n/a | 2.49 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 0.19 | 2.42 | 1.00 | |||
| VCaP (prostate carcinoma) | 2.40 | -1.43 | 2.00 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fasting insulin, hip bone mineral density (bmd), homa-b, mitral annular calcium, stabilized warfarin dose