rs2801220 chr1:108042027 A>G
- Sequence
aaaacctctagaaagggctcaaat[A/G]cataagatagagatcacatggggc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF1_HUMAN RAD51_HUMAN IKZF2_HUMAN SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -1.66 | 2.13 | 1.00 | n/a | n/a | |||
| RAD51_HUMAN | -2.21 | 2.59 | 1.00 | n/a | n/a | |||
| IKZF2_HUMAN | -2.26 | 2.22 | 1.00 | n/a | n/a | |||
| SRF_HUMAN | -1.85 | 2.25 | 1.00 | n/a | No Hit | |||
| MTA2_HUMAN | -2.00 | 2.38 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood