rs2802055 chr6:65835863 T>C
- Sequence
gtgatacacatcttaagtaactaa[T/C]gtagtgagcccaatgcagaagaat
- ASB in cell types
- breast tumor T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.16 | 0.64 | 2.00 | |||
| T47D (invasive ductal carcinoma) | 0.54 | 1.18 | 2.33 |
Items per page:
1 – 2 of 2