rs280224 chr2:121059276 T>C
- Sequence
tacattaatgtccacactctggtg[T/C]gtcaccagcttcctcgaggttctg
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.13 | 0.93 | 1.15 |
Items per page:
1 – 1 of 1